ID: 1054530908

View in Genome Browser
Species Human (GRCh38)
Location 9:66181725-66181747
Sequence AACCCAGGATCCCATGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054530905_1054530908 1 Left 1054530905 9:66181701-66181723 CCTGCCTGGCTTCTTCTGCTGTT No data
Right 1054530908 9:66181725-66181747 AACCCAGGATCCCATGCTCTAGG No data
1054530904_1054530908 8 Left 1054530904 9:66181694-66181716 CCAAGCTCCTGCCTGGCTTCTTC No data
Right 1054530908 9:66181725-66181747 AACCCAGGATCCCATGCTCTAGG No data
1054530898_1054530908 24 Left 1054530898 9:66181678-66181700 CCTCTCTCCAGTGCCCCCAAGCT No data
Right 1054530908 9:66181725-66181747 AACCCAGGATCCCATGCTCTAGG No data
1054530902_1054530908 10 Left 1054530902 9:66181692-66181714 CCCCAAGCTCCTGCCTGGCTTCT No data
Right 1054530908 9:66181725-66181747 AACCCAGGATCCCATGCTCTAGG No data
1054530903_1054530908 9 Left 1054530903 9:66181693-66181715 CCCAAGCTCCTGCCTGGCTTCTT No data
Right 1054530908 9:66181725-66181747 AACCCAGGATCCCATGCTCTAGG No data
1054530906_1054530908 -3 Left 1054530906 9:66181705-66181727 CCTGGCTTCTTCTGCTGTTCAAC No data
Right 1054530908 9:66181725-66181747 AACCCAGGATCCCATGCTCTAGG No data
1054530901_1054530908 11 Left 1054530901 9:66181691-66181713 CCCCCAAGCTCCTGCCTGGCTTC No data
Right 1054530908 9:66181725-66181747 AACCCAGGATCCCATGCTCTAGG No data
1054530899_1054530908 17 Left 1054530899 9:66181685-66181707 CCAGTGCCCCCAAGCTCCTGCCT No data
Right 1054530908 9:66181725-66181747 AACCCAGGATCCCATGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054530908 Original CRISPR AACCCAGGATCCCATGCTCT AGG Intergenic
No off target data available for this crispr