ID: 1054533489

View in Genome Browser
Species Human (GRCh38)
Location 9:66205620-66205642
Sequence GTGGCGGTTCAGCAATTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054533489_1054533497 10 Left 1054533489 9:66205620-66205642 CCATCAAATTGCTGAACCGCCAC No data
Right 1054533497 9:66205653-66205675 AAAGTTTCCGTCATGGCCTGGGG No data
1054533489_1054533495 8 Left 1054533489 9:66205620-66205642 CCATCAAATTGCTGAACCGCCAC No data
Right 1054533495 9:66205651-66205673 ACAAAGTTTCCGTCATGGCCTGG No data
1054533489_1054533502 21 Left 1054533489 9:66205620-66205642 CCATCAAATTGCTGAACCGCCAC No data
Right 1054533502 9:66205664-66205686 CATGGCCTGGGGGGATCTTAGGG No data
1054533489_1054533498 11 Left 1054533489 9:66205620-66205642 CCATCAAATTGCTGAACCGCCAC No data
Right 1054533498 9:66205654-66205676 AAGTTTCCGTCATGGCCTGGGGG No data
1054533489_1054533503 22 Left 1054533489 9:66205620-66205642 CCATCAAATTGCTGAACCGCCAC No data
Right 1054533503 9:66205665-66205687 ATGGCCTGGGGGGATCTTAGGGG No data
1054533489_1054533496 9 Left 1054533489 9:66205620-66205642 CCATCAAATTGCTGAACCGCCAC No data
Right 1054533496 9:66205652-66205674 CAAAGTTTCCGTCATGGCCTGGG No data
1054533489_1054533499 12 Left 1054533489 9:66205620-66205642 CCATCAAATTGCTGAACCGCCAC No data
Right 1054533499 9:66205655-66205677 AGTTTCCGTCATGGCCTGGGGGG No data
1054533489_1054533501 20 Left 1054533489 9:66205620-66205642 CCATCAAATTGCTGAACCGCCAC No data
Right 1054533501 9:66205663-66205685 TCATGGCCTGGGGGGATCTTAGG No data
1054533489_1054533494 3 Left 1054533489 9:66205620-66205642 CCATCAAATTGCTGAACCGCCAC No data
Right 1054533494 9:66205646-66205668 CGCTAACAAAGTTTCCGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054533489 Original CRISPR GTGGCGGTTCAGCAATTTGA TGG (reversed) Intergenic
No off target data available for this crispr