ID: 1054537059

View in Genome Browser
Species Human (GRCh38)
Location 9:66244268-66244290
Sequence TCCCTGCCCCATGGGACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054537051_1054537059 5 Left 1054537051 9:66244240-66244262 CCCTCGAGGAGCTCCATCTTCCC No data
Right 1054537059 9:66244268-66244290 TCCCTGCCCCATGGGACCCTGGG No data
1054537052_1054537059 4 Left 1054537052 9:66244241-66244263 CCTCGAGGAGCTCCATCTTCCCT No data
Right 1054537059 9:66244268-66244290 TCCCTGCCCCATGGGACCCTGGG No data
1054537048_1054537059 17 Left 1054537048 9:66244228-66244250 CCCCTTGTCAGGCCCTCGAGGAG No data
Right 1054537059 9:66244268-66244290 TCCCTGCCCCATGGGACCCTGGG No data
1054537049_1054537059 16 Left 1054537049 9:66244229-66244251 CCCTTGTCAGGCCCTCGAGGAGC No data
Right 1054537059 9:66244268-66244290 TCCCTGCCCCATGGGACCCTGGG No data
1054537053_1054537059 -8 Left 1054537053 9:66244253-66244275 CCATCTTCCCTTGTTTCCCTGCC No data
Right 1054537059 9:66244268-66244290 TCCCTGCCCCATGGGACCCTGGG No data
1054537050_1054537059 15 Left 1054537050 9:66244230-66244252 CCTTGTCAGGCCCTCGAGGAGCT No data
Right 1054537059 9:66244268-66244290 TCCCTGCCCCATGGGACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054537059 Original CRISPR TCCCTGCCCCATGGGACCCT GGG Intergenic