ID: 1054541420

View in Genome Browser
Species Human (GRCh38)
Location 9:66268899-66268921
Sequence GAGTTGAATTTGAAGTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054541420_1054541426 1 Left 1054541420 9:66268899-66268921 CCCACAAACTTCAAATTCAACTC No data
Right 1054541426 9:66268923-66268945 TGGGCCTTCTGTCCGAGTTGGGG No data
1054541420_1054541425 0 Left 1054541420 9:66268899-66268921 CCCACAAACTTCAAATTCAACTC No data
Right 1054541425 9:66268922-66268944 ATGGGCCTTCTGTCCGAGTTGGG No data
1054541420_1054541433 30 Left 1054541420 9:66268899-66268921 CCCACAAACTTCAAATTCAACTC No data
Right 1054541433 9:66268952-66268974 TAGTGGCCCGACGCGCACCCTGG No data
1054541420_1054541429 13 Left 1054541420 9:66268899-66268921 CCCACAAACTTCAAATTCAACTC No data
Right 1054541429 9:66268935-66268957 CCGAGTTGGGGTACCCCTAGTGG No data
1054541420_1054541424 -1 Left 1054541420 9:66268899-66268921 CCCACAAACTTCAAATTCAACTC No data
Right 1054541424 9:66268921-66268943 CATGGGCCTTCTGTCCGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054541420 Original CRISPR GAGTTGAATTTGAAGTTTGT GGG (reversed) Intergenic
No off target data available for this crispr