ID: 1054543133

View in Genome Browser
Species Human (GRCh38)
Location 9:66288633-66288655
Sequence TCCCAGGCACATGGTGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054543133_1054543141 25 Left 1054543133 9:66288633-66288655 CCAACAACACCATGTGCCTGGGA No data
Right 1054543141 9:66288681-66288703 CACAAAAGCAGCCAGAAGGCAGG No data
1054543133_1054543138 21 Left 1054543133 9:66288633-66288655 CCAACAACACCATGTGCCTGGGA No data
Right 1054543138 9:66288677-66288699 AGCCCACAAAAGCAGCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054543133 Original CRISPR TCCCAGGCACATGGTGTTGT TGG (reversed) Intergenic
No off target data available for this crispr