ID: 1054543135

View in Genome Browser
Species Human (GRCh38)
Location 9:66288649-66288671
Sequence TGAGTGTCTGTGGCTTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5526
Summary {0: 21, 1: 856, 2: 1242, 3: 1675, 4: 1732}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054543135_1054543138 5 Left 1054543135 9:66288649-66288671 CCTGGGAAAGCCACAGACACTCA 0: 21
1: 856
2: 1242
3: 1675
4: 1732
Right 1054543138 9:66288677-66288699 AGCCCACAAAAGCAGCCAGAAGG No data
1054543135_1054543141 9 Left 1054543135 9:66288649-66288671 CCTGGGAAAGCCACAGACACTCA 0: 21
1: 856
2: 1242
3: 1675
4: 1732
Right 1054543141 9:66288681-66288703 CACAAAAGCAGCCAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054543135 Original CRISPR TGAGTGTCTGTGGCTTTCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr