ID: 1054543136

View in Genome Browser
Species Human (GRCh38)
Location 9:66288659-66288681
Sequence GGGCTGGTGTTGAGTGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3690
Summary {0: 134, 1: 379, 2: 751, 3: 1024, 4: 1402}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054543136_1054543138 -5 Left 1054543136 9:66288659-66288681 CCACAGACACTCAACACCAGCCC 0: 134
1: 379
2: 751
3: 1024
4: 1402
Right 1054543138 9:66288677-66288699 AGCCCACAAAAGCAGCCAGAAGG No data
1054543136_1054543143 21 Left 1054543136 9:66288659-66288681 CCACAGACACTCAACACCAGCCC 0: 134
1: 379
2: 751
3: 1024
4: 1402
Right 1054543143 9:66288703-66288725 GCTATATCCCGCAAAGCCACAGG No data
1054543136_1054543141 -1 Left 1054543136 9:66288659-66288681 CCACAGACACTCAACACCAGCCC 0: 134
1: 379
2: 751
3: 1024
4: 1402
Right 1054543141 9:66288681-66288703 CACAAAAGCAGCCAGAAGGCAGG No data
1054543136_1054543144 22 Left 1054543136 9:66288659-66288681 CCACAGACACTCAACACCAGCCC 0: 134
1: 379
2: 751
3: 1024
4: 1402
Right 1054543144 9:66288704-66288726 CTATATCCCGCAAAGCCACAGGG No data
1054543136_1054543145 23 Left 1054543136 9:66288659-66288681 CCACAGACACTCAACACCAGCCC 0: 134
1: 379
2: 751
3: 1024
4: 1402
Right 1054543145 9:66288705-66288727 TATATCCCGCAAAGCCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054543136 Original CRISPR GGGCTGGTGTTGAGTGTCTG TGG (reversed) Intergenic
Too many off-targets to display for this crispr