ID: 1054543141

View in Genome Browser
Species Human (GRCh38)
Location 9:66288681-66288703
Sequence CACAAAAGCAGCCAGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054543136_1054543141 -1 Left 1054543136 9:66288659-66288681 CCACAGACACTCAACACCAGCCC 0: 134
1: 379
2: 751
3: 1024
4: 1402
Right 1054543141 9:66288681-66288703 CACAAAAGCAGCCAGAAGGCAGG No data
1054543133_1054543141 25 Left 1054543133 9:66288633-66288655 CCAACAACACCATGTGCCTGGGA No data
Right 1054543141 9:66288681-66288703 CACAAAAGCAGCCAGAAGGCAGG No data
1054543134_1054543141 16 Left 1054543134 9:66288642-66288664 CCATGTGCCTGGGAAAGCCACAG No data
Right 1054543141 9:66288681-66288703 CACAAAAGCAGCCAGAAGGCAGG No data
1054543135_1054543141 9 Left 1054543135 9:66288649-66288671 CCTGGGAAAGCCACAGACACTCA 0: 21
1: 856
2: 1242
3: 1675
4: 1732
Right 1054543141 9:66288681-66288703 CACAAAAGCAGCCAGAAGGCAGG No data
1054543130_1054543141 28 Left 1054543130 9:66288630-66288652 CCACCAACAACACCATGTGCCTG No data
Right 1054543141 9:66288681-66288703 CACAAAAGCAGCCAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054543141 Original CRISPR CACAAAAGCAGCCAGAAGGC AGG Intergenic
No off target data available for this crispr