ID: 1054547207

View in Genome Browser
Species Human (GRCh38)
Location 9:66349566-66349588
Sequence CTGTTGTTGTTAAGAAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054547204_1054547207 26 Left 1054547204 9:66349517-66349539 CCTGATTCTAGGTGCATGTGGCA No data
Right 1054547207 9:66349566-66349588 CTGTTGTTGTTAAGAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054547207 Original CRISPR CTGTTGTTGTTAAGAAAATA AGG Intergenic
No off target data available for this crispr