ID: 1054549918

View in Genome Browser
Species Human (GRCh38)
Location 9:66390503-66390525
Sequence TTGCCTAATCATGAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054549918_1054549928 30 Left 1054549918 9:66390503-66390525 CCCGCCTCCTCATGATTAGGCAA No data
Right 1054549928 9:66390556-66390578 CCCATTGAAAGGGCTGTTGAAGG No data
1054549918_1054549926 20 Left 1054549918 9:66390503-66390525 CCCGCCTCCTCATGATTAGGCAA No data
Right 1054549926 9:66390546-66390568 ATAGTAGCAACCCATTGAAAGGG No data
1054549918_1054549925 19 Left 1054549918 9:66390503-66390525 CCCGCCTCCTCATGATTAGGCAA No data
Right 1054549925 9:66390545-66390567 AATAGTAGCAACCCATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054549918 Original CRISPR TTGCCTAATCATGAGGAGGC GGG (reversed) Intergenic
No off target data available for this crispr