ID: 1054550661

View in Genome Browser
Species Human (GRCh38)
Location 9:66598801-66598823
Sequence CTGCAGCAACAGAAGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054550661_1054550664 0 Left 1054550661 9:66598801-66598823 CCATTTTCCTTCTGTTGCTGCAG No data
Right 1054550664 9:66598824-66598846 TTTGGAAGTAGTTTGTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054550661 Original CRISPR CTGCAGCAACAGAAGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr