ID: 1054550664

View in Genome Browser
Species Human (GRCh38)
Location 9:66598824-66598846
Sequence TTTGGAAGTAGTTTGTTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054550661_1054550664 0 Left 1054550661 9:66598801-66598823 CCATTTTCCTTCTGTTGCTGCAG No data
Right 1054550664 9:66598824-66598846 TTTGGAAGTAGTTTGTTATCAGG No data
1054550663_1054550664 -7 Left 1054550663 9:66598808-66598830 CCTTCTGTTGCTGCAGTTTGGAA No data
Right 1054550664 9:66598824-66598846 TTTGGAAGTAGTTTGTTATCAGG No data
1054550660_1054550664 4 Left 1054550660 9:66598797-66598819 CCTACCATTTTCCTTCTGTTGCT No data
Right 1054550664 9:66598824-66598846 TTTGGAAGTAGTTTGTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054550664 Original CRISPR TTTGGAAGTAGTTTGTTATC AGG Intergenic
No off target data available for this crispr