ID: 1054554060

View in Genome Browser
Species Human (GRCh38)
Location 9:66635914-66635936
Sequence TAAGATATACACAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054554060_1054554070 23 Left 1054554060 9:66635914-66635936 CCCTCCCCCTTGTGTATATCTTA No data
Right 1054554070 9:66635960-66635982 AAATAACAAATGAAATGCGATGG No data
1054554060_1054554069 -9 Left 1054554060 9:66635914-66635936 CCCTCCCCCTTGTGTATATCTTA No data
Right 1054554069 9:66635928-66635950 TATATCTTATGGGCAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054554060 Original CRISPR TAAGATATACACAAGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr