ID: 1054556731

View in Genome Browser
Species Human (GRCh38)
Location 9:66664714-66664736
Sequence AAGTATCCACAGTGGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054556731_1054556737 11 Left 1054556731 9:66664714-66664736 CCATCCTGCCACTGTGGATACTT No data
Right 1054556737 9:66664748-66664770 CTACTGGGAGATGACAGAAGTGG No data
1054556731_1054556738 15 Left 1054556731 9:66664714-66664736 CCATCCTGCCACTGTGGATACTT No data
Right 1054556738 9:66664752-66664774 TGGGAGATGACAGAAGTGGCTGG No data
1054556731_1054556739 24 Left 1054556731 9:66664714-66664736 CCATCCTGCCACTGTGGATACTT No data
Right 1054556739 9:66664761-66664783 ACAGAAGTGGCTGGCGAAAGAGG No data
1054556731_1054556734 -5 Left 1054556731 9:66664714-66664736 CCATCCTGCCACTGTGGATACTT No data
Right 1054556734 9:66664732-66664754 TACTTTGTTCCTAAGTCTACTGG No data
1054556731_1054556735 -4 Left 1054556731 9:66664714-66664736 CCATCCTGCCACTGTGGATACTT No data
Right 1054556735 9:66664733-66664755 ACTTTGTTCCTAAGTCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054556731 Original CRISPR AAGTATCCACAGTGGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr