ID: 1054556832 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:66665514-66665536 |
| Sequence | AGTTATTCACAGGAGATGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1054556828_1054556832 | 4 | Left | 1054556828 | 9:66665487-66665509 | CCAAGAGTTGTTTCTCAAAAGGA | 0: 6 1: 30 2: 252 3: 273 4: 455 |
||
| Right | 1054556832 | 9:66665514-66665536 | AGTTATTCACAGGAGATGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1054556832 | Original CRISPR | AGTTATTCACAGGAGATGGC AGG | Intergenic | ||
| No off target data available for this crispr | |||||