ID: 1054556832

View in Genome Browser
Species Human (GRCh38)
Location 9:66665514-66665536
Sequence AGTTATTCACAGGAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054556828_1054556832 4 Left 1054556828 9:66665487-66665509 CCAAGAGTTGTTTCTCAAAAGGA 0: 6
1: 30
2: 252
3: 273
4: 455
Right 1054556832 9:66665514-66665536 AGTTATTCACAGGAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054556832 Original CRISPR AGTTATTCACAGGAGATGGC AGG Intergenic
No off target data available for this crispr