ID: 1054557034

View in Genome Browser
Species Human (GRCh38)
Location 9:66667203-66667225
Sequence GGGTGCCTTCTCATGAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054557031_1054557034 1 Left 1054557031 9:66667179-66667201 CCTTGGTGCTGTTCTCATGACAG No data
Right 1054557034 9:66667203-66667225 GGGTGCCTTCTCATGAGATCTGG No data
1054557029_1054557034 7 Left 1054557029 9:66667173-66667195 CCATTCCCTTGGTGCTGTTCTCA No data
Right 1054557034 9:66667203-66667225 GGGTGCCTTCTCATGAGATCTGG No data
1054557030_1054557034 2 Left 1054557030 9:66667178-66667200 CCCTTGGTGCTGTTCTCATGACA 0: 22
1: 146
2: 334
3: 744
4: 978
Right 1054557034 9:66667203-66667225 GGGTGCCTTCTCATGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054557034 Original CRISPR GGGTGCCTTCTCATGAGATC TGG Intergenic
No off target data available for this crispr