ID: 1054560348

View in Genome Browser
Species Human (GRCh38)
Location 9:66703531-66703553
Sequence TTGGACTCACAACTAGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054560348_1054560354 1 Left 1054560348 9:66703531-66703553 CCTTACTCTAGTTGTGAGTCCAA No data
Right 1054560354 9:66703555-66703577 GGTAGGCATGGAATTGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054560348 Original CRISPR TTGGACTCACAACTAGAGTA AGG (reversed) Intergenic
No off target data available for this crispr