ID: 1054564228

View in Genome Browser
Species Human (GRCh38)
Location 9:66744075-66744097
Sequence AGGGGAAATAAGAGGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054564221_1054564228 16 Left 1054564221 9:66744036-66744058 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1054564228 9:66744075-66744097 AGGGGAAATAAGAGGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054564228 Original CRISPR AGGGGAAATAAGAGGGATGC TGG Intergenic
No off target data available for this crispr