ID: 1054568234

View in Genome Browser
Species Human (GRCh38)
Location 9:66782236-66782258
Sequence CTATTGGTATGGAGGACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054568234_1054568240 4 Left 1054568234 9:66782236-66782258 CCTTCTGTCCTCCATACCAATAG No data
Right 1054568240 9:66782263-66782285 TTACAGCTGATTTGGTTGTTTGG No data
1054568234_1054568239 -4 Left 1054568234 9:66782236-66782258 CCTTCTGTCCTCCATACCAATAG No data
Right 1054568239 9:66782255-66782277 ATAGGCAGTTACAGCTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054568234 Original CRISPR CTATTGGTATGGAGGACAGA AGG (reversed) Intergenic
No off target data available for this crispr