ID: 1054570161

View in Genome Browser
Species Human (GRCh38)
Location 9:66801752-66801774
Sequence TGTGGTCCCAATTACTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054570161_1054570166 -4 Left 1054570161 9:66801752-66801774 CCACCCTAGTAATTGGGACCACA No data
Right 1054570166 9:66801771-66801793 CACAGGCGTGCCACTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054570161 Original CRISPR TGTGGTCCCAATTACTAGGG TGG (reversed) Intergenic
No off target data available for this crispr