ID: 1054576348

View in Genome Browser
Species Human (GRCh38)
Location 9:66862744-66862766
Sequence TCTAACAATCCCACTTCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054576348_1054576350 10 Left 1054576348 9:66862744-66862766 CCATAAGAAGTGGGATTGTTAGA 0: 2
1: 0
2: 1
3: 13
4: 146
Right 1054576350 9:66862777-66862799 GTTCTGTCTTGAATTTTTTGAGG No data
1054576348_1054576351 16 Left 1054576348 9:66862744-66862766 CCATAAGAAGTGGGATTGTTAGA 0: 2
1: 0
2: 1
3: 13
4: 146
Right 1054576351 9:66862783-66862805 TCTTGAATTTTTTGAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054576348 Original CRISPR TCTAACAATCCCACTTCTTA TGG (reversed) Intronic
900352748 1:2243926-2243948 TAAAACAATCCCACCTTTTAGGG - Intronic
903062943 1:20682985-20683007 TCCAACAACCCCACTTCACAGGG + Intronic
903405424 1:23091521-23091543 TCTGAGAAGCCCACTTCTGAAGG + Exonic
908042120 1:60126022-60126044 TCTTACAATCCCAGGTCTCATGG - Intergenic
909444504 1:75733686-75733708 TCTAAAAATCCAACTTCTTCAGG - Intronic
911257157 1:95646052-95646074 TCTAACAATCCAGCTGCTTCAGG + Intergenic
912587773 1:110782408-110782430 TAAAACAATCCCTATTCTTAAGG - Intergenic
917079783 1:171245742-171245764 TCTACCAATTCAGCTTCTTAGGG + Intergenic
917462884 1:175247464-175247486 TCTATCAATCCAACTGCTTCAGG - Intergenic
917882552 1:179352418-179352440 CCTGGCAATCCTACTTCTTAGGG - Intronic
918403264 1:184185914-184185936 ACTGACAATCCCAGTTCTGAAGG + Intergenic
919036555 1:192318409-192318431 TCTAACATTCCCCCTCCTTGGGG + Intronic
921257494 1:213355478-213355500 TCTGATATTCTCACTTCTTAGGG + Intergenic
1063699592 10:8371539-8371561 TCAACCACTCCCACTGCTTATGG - Intergenic
1064417946 10:15167512-15167534 TCGAAAAATCTCACTTCTAAGGG + Intronic
1064484248 10:15768187-15768209 TCCAACAATCCAACATTTTAGGG - Intergenic
1065110410 10:22435667-22435689 TCTAACTCTCCCACTTCTCTGGG + Intronic
1066599623 10:37090847-37090869 TCCTACAGTCCCACTGCTTAGGG - Intergenic
1071378560 10:85034664-85034686 TCTATCAATCCAACTGCTTCAGG - Intergenic
1075281446 10:121142317-121142339 GCTCACATTCCCACTTCTTTTGG - Intergenic
1075606973 10:123818710-123818732 TCTATCAATCCAACTGCTTCAGG - Intronic
1078270394 11:9789291-9789313 TGTAGTAATCCCACTTCTTGAGG + Exonic
1083569500 11:63750355-63750377 TCTAACTTGGCCACTTCTTAAGG - Intronic
1085890773 11:80576028-80576050 TCCTACAGTCCCACTGCTTAAGG + Intergenic
1086298250 11:85395809-85395831 TCTATCGATTCCACTTCTAAGGG + Intronic
1088936086 11:114401313-114401335 TCAAACAATACCAGTTATTAGGG - Intronic
1092324810 12:7519146-7519168 TCCAGCAATCCCACTGCTTTTGG - Intergenic
1093269082 12:17036511-17036533 TCTAAAAATCACACTTCTCTAGG - Intergenic
1094382409 12:29857195-29857217 TCTAACAATGCAAATTCTCAAGG - Intergenic
1094770067 12:33646914-33646936 TCTAAATATTCCACTCCTTACGG - Intergenic
1095495950 12:42783784-42783806 TCTAACAATCCCAAAACTCAGGG - Intergenic
1104421214 12:128637118-128637140 TCCAGCAATCCCACTTCTGGAGG - Intronic
1105980817 13:25514589-25514611 TCTCACAAGCCCCCTTCTTCTGG - Intronic
1107016071 13:35708637-35708659 TCTGGCAACCCTACTTCTTAGGG + Intergenic
1107669692 13:42732116-42732138 TCAAAATATCCCACTTCTTTAGG - Intergenic
1107983404 13:45754690-45754712 TCTAACAATCCAGCTGCTTCAGG + Intergenic
1116059073 14:39898206-39898228 TCTATCAATCCAGCTTCTTCAGG - Intergenic
1118694150 14:68367799-68367821 ACTAATAATCCCACTTCCTCAGG - Intronic
1119284546 14:73442019-73442041 CCTAGCAATTCCACTACTTATGG + Intronic
1119634500 14:76262965-76262987 AGTGACAATCCCACTACTTAGGG + Intergenic
1122464972 14:101926137-101926159 TCTAAGAATTCCACATTTTATGG + Exonic
1127372679 15:58355591-58355613 TCTAAAAATACCACTTCTTTTGG - Intronic
1127567791 15:60209966-60209988 TCCAGCAATACCACTTCTTTTGG - Intergenic
1127925884 15:63540770-63540792 TGACACAAACCCACTTCTTAAGG + Intronic
1145833682 17:27937638-27937660 TGTATCAAACCCAGTTCTTAAGG + Intergenic
1149233194 17:54560140-54560162 TCCAGCAATCCCACTTTTAAAGG + Intergenic
1150667322 17:67153577-67153599 TATAATAATTCAACTTCTTAAGG + Intronic
1151026981 17:70688826-70688848 TCTTAAAATCTCAGTTCTTATGG - Intergenic
1153923245 18:9809799-9809821 TTTGACAATTCCACCTCTTAAGG - Intronic
1155292393 18:24355214-24355236 TCTAGCATGCCCACTTATTAAGG + Intronic
1159063356 18:63540436-63540458 TCTTAAAATCCCACTGCTGATGG + Intergenic
1162239530 19:9338287-9338309 TTTAACAATCCCATTTTATAAGG - Intronic
926005996 2:9373834-9373856 TTTTACAATCCCAATTCTGAAGG - Intronic
926976100 2:18518536-18518558 GCTTACTATCCCACTACTTACGG - Intergenic
929029706 2:37638881-37638903 TTTAACAATGCCCCTGCTTACGG + Intergenic
929550482 2:42887587-42887609 TCTATCAAGCCAACTTCTTCAGG - Intergenic
930805119 2:55482860-55482882 TCTAACAATCCCAGTATTTTGGG + Intergenic
932059154 2:68477928-68477950 TGTAACAATCCCACATGTCAAGG - Intronic
935035665 2:99370134-99370156 TCTAAAAATGCCAATTTTTATGG - Intronic
941583193 2:167325629-167325651 TCCAGCAATCCCACTTGATATGG - Intergenic
942548103 2:177085787-177085809 TCTCACAATCCCACTTATGAAGG + Intergenic
946131465 2:217610134-217610156 TCTAACAATGCCACATGTTGAGG - Intronic
947414089 2:229875480-229875502 TCTAACACTCCCTCATCATACGG + Intronic
947460982 2:230305384-230305406 TCCAGCAATCCCACTACTGACGG + Intronic
947464422 2:230328680-230328702 TTCAACAATTCCACTTTTTAAGG - Intronic
1169313293 20:4566558-4566580 TCTAGCAATCCCACTCCTTCTGG + Intergenic
1169794301 20:9445025-9445047 TGTCAAAATACCACTTCTTATGG - Intronic
1173015077 20:39217857-39217879 TTTTATAATCCCACTTCTTAAGG + Intergenic
1178100359 21:29261581-29261603 GCTATCAATCACACTTTTTAAGG + Intronic
1182678521 22:32059738-32059760 TCTCACAATCCCATCTCTTGAGG + Intronic
949168414 3:968546-968568 TCTACCAGTTCCACTTCTAAGGG + Intergenic
951086722 3:18520540-18520562 TCTATCAATCCGTCTTCTTCAGG - Intergenic
951306599 3:21070622-21070644 TGTAATAATCCCACTTGTCAAGG - Intergenic
951355200 3:21658475-21658497 TCCATCAATTACACTTCTTATGG + Intronic
951360070 3:21714482-21714504 TCTACCACTCCCACTTTTTATGG + Intronic
951399892 3:22218996-22219018 TCTAGCAATTCCTCTTTTTATGG + Intronic
957210834 3:77256167-77256189 TCTATTAATCCCACTTCTGCTGG - Intronic
958512897 3:95071871-95071893 TACAACAATTCCACTTCTTCGGG + Intergenic
958845603 3:99261146-99261168 TCTATCAATCCACCTTCTTCAGG + Intergenic
959745839 3:109776001-109776023 TCTATCAATCCAGCTTCTTCAGG + Intergenic
960992212 3:123319413-123319435 GTTAACATTCCCACTTCGTAGGG - Intronic
961708601 3:128809205-128809227 TTTAACAATCTAACTTCTTAAGG - Intronic
961710800 3:128826739-128826761 TCTATCAATCCAGCTGCTTAAGG + Intergenic
962373985 3:134845295-134845317 TTCATCAATCCCACATCTTATGG - Intronic
962669020 3:137686059-137686081 TCTTATAGTCCCACTTTTTAAGG - Intergenic
964387092 3:156159261-156159283 TCTAAAACTCTGACTTCTTAGGG + Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
973134726 4:46692754-46692776 TCCAAAAATCCCAGTTTTTAAGG - Intergenic
973201439 4:47507546-47507568 TCTTACACTCCTACTTCTAATGG + Intronic
974459182 4:62165529-62165551 TCTATCAATCCAGCTTCTTCAGG - Intergenic
974727396 4:65813814-65813836 TCTATCAATCCAACTCCTTCAGG - Intergenic
975728542 4:77316025-77316047 CCTAACTCTCCCACTTGTTATGG - Intronic
976420077 4:84831967-84831989 TCTAGCAATCCCCCTACTGAGGG + Intronic
978542609 4:109834852-109834874 TCTGACAATCCCAAATGTTAAGG - Intronic
978797701 4:112724783-112724805 TCTAGCAGTCCCACTTCTAGAGG + Intergenic
979111234 4:116760853-116760875 TTTAACAAGCACAGTTCTTAAGG - Intergenic
980385627 4:132085780-132085802 TCTATCAATCCAGCTTCTTCAGG + Intergenic
981062244 4:140437280-140437302 TCTAACAAGGCAACTTCTTTTGG - Intergenic
981623945 4:146735566-146735588 TTGAACAGTCCCCCTTCTTAGGG - Intronic
982112357 4:152068413-152068435 TAGAACAGTCCCACTTCTTAGGG + Intergenic
984174764 4:176403642-176403664 TCTGACTCTCCCACTTCTCAGGG + Intergenic
984671469 4:182493471-182493493 TTTTACAATCCCATTTCATAAGG - Intronic
989483324 5:41958554-41958576 TCTCACCATCCCCCTTCTTCTGG + Intergenic
990643567 5:57816748-57816770 TCAAACAATTCCACCTCTAAAGG - Intergenic
992036701 5:72786072-72786094 TCTGTCAATCTCACTTCTGAAGG - Intergenic
999503221 5:152167555-152167577 TCCAACAATTCCATTCCTTAGGG - Intergenic
999648382 5:153741382-153741404 TCCAGCAATCCCACTTCTAGGGG + Intronic
1000641105 5:163702765-163702787 TCTAAAAATGCAACTTGTTAGGG - Intergenic
1002336946 5:178486204-178486226 TCGAACACTCCCACATCTTCAGG - Intronic
1004689983 6:17985460-17985482 GCTAACAGTCGCACTGCTTATGG + Intronic
1005807056 6:29483954-29483976 TTTCACAATCCCATTTCTTTTGG + Intergenic
1012190533 6:96274592-96274614 TCTAAGATGCCCACTTCCTAGGG - Intergenic
1012935251 6:105360869-105360891 TCAAACAATTCCACTTCACAAGG + Intronic
1016119763 6:140331415-140331437 TCTATCAATCCAACTGCTTCAGG + Intergenic
1017538145 6:155370825-155370847 TCTAAGTTTCCCACTTCTAAAGG - Intergenic
1018767837 6:166947706-166947728 TCCACCAATCCCTCTTCCTAAGG + Intronic
1023070691 7:36429654-36429676 TCGTAAAATCCCAATTCTTATGG - Intronic
1024430398 7:49282084-49282106 TCTAACATTCCCACTACATGTGG - Intergenic
1028141911 7:87283317-87283339 TCTATCAATCCAACTGCTTCAGG - Intergenic
1028331285 7:89596010-89596032 TATAGGAATCCCCCTTCTTAAGG + Intergenic
1028914372 7:96242670-96242692 TCTAATAATCCCAGGTCTTTAGG + Intronic
1028915139 7:96250846-96250868 TCTAAGAATCCCACCTCTTCTGG + Intronic
1029179558 7:98690211-98690233 TCCAACAATTCCTCTTCTTCAGG + Intergenic
1030175384 7:106648139-106648161 TCTAACAATCTTACTTGTTGTGG - Intergenic
1030621686 7:111797296-111797318 TCTAAAAATCCCCCTTATTTGGG + Intronic
1031835541 7:126677329-126677351 TCTAGCAATCCCACTACTAGGGG + Intronic
1033276324 7:139974270-139974292 TTTTGCAGTCCCACTTCTTAAGG + Intronic
1036858710 8:12325473-12325495 TCTAACCATTCTATTTCTTAGGG - Intergenic
1037005579 8:13775711-13775733 TCCAATGATCCTACTTCTTACGG + Intergenic
1038261562 8:26000569-26000591 ACTAACAATTCCATTTATTAGGG - Intronic
1038374529 8:27025535-27025557 ACTAAAAATACCACTTCATAAGG - Intergenic
1040441793 8:47450932-47450954 TCTAATTATCCCACTCCTCAGGG - Intronic
1041360999 8:57054173-57054195 TCTGACAATCCAGCTCCTTATGG - Intergenic
1042261868 8:66868263-66868285 TATAACAATCCCACCACTTTGGG + Intergenic
1044520976 8:93199021-93199043 TTTAACAATCTCACTGCTTTGGG + Intergenic
1044544291 8:93442456-93442478 TCCAATAATCCCACTTCTAAGGG + Intergenic
1044544301 8:93442518-93442540 TCCAACAATCCCACTTCTAAGGG - Intergenic
1045857021 8:106776118-106776140 TTTAACAATCCTACTTCTTCTGG + Intergenic
1049374953 8:142285018-142285040 TCCATCTATCCCACTTCTTTAGG - Intronic
1050056830 9:1664355-1664377 TCCAATCATCCCACTTCTTAAGG - Intergenic
1050110737 9:2212959-2212981 TCTAAAAATCTCACTTCCCAGGG - Intergenic
1052745177 9:32433493-32433515 TCTATTAATCCCATTACTTAGGG - Intronic
1053589952 9:39502547-39502569 TCTAACAATCCCACTTCTTATGG + Intergenic
1054576348 9:66862744-66862766 TCTAACAATCCCACTTCTTATGG - Intronic
1054874273 9:70078928-70078950 TCCAACATCCCCACTTCCTAAGG - Intronic
1055444682 9:76370835-76370857 TGGAACTTTCCCACTTCTTAGGG - Intergenic
1056084685 9:83134735-83134757 CCCAACAATTCCACTTCTAAGGG + Intergenic
1056257277 9:84813048-84813070 TCTAAAAAGCACATTTCTTATGG - Intronic
1056270475 9:84943640-84943662 ACTGACAATCCCTCTTCTTCAGG - Intronic
1057588114 9:96347636-96347658 TCTGACAATCCCAGTACTTTGGG - Intronic
1058194111 9:101953100-101953122 GCTAACAATTGCACTTCTTTTGG - Intergenic
1058899284 9:109428177-109428199 TCTATAATGCCCACTTCTTAGGG - Intronic
1059355788 9:113698420-113698442 TCTCACTTCCCCACTTCTTAAGG + Intergenic
1060900757 9:127255867-127255889 TCTAGGAATCTCACTTCCTAGGG + Intronic
1062135654 9:134926280-134926302 TCTATCAATCCAACTACTTCAGG - Intergenic
1185919138 X:4069721-4069743 CCTAACAATCCCACTCCTACAGG - Intergenic
1190476181 X:50829910-50829932 TCTAACATTACCACTTCATATGG + Intergenic
1198323735 X:135545715-135545737 TTTAAAAATCCCTCTTCTTTTGG + Intronic
1198967391 X:142242342-142242364 TGTAACAATTTCACTTCTCATGG - Intergenic
1200020338 X:153198942-153198964 TTTAACAAACACACTTCATAAGG + Intergenic
1200340300 X:155389366-155389388 TCTATCAATCCAGCTTCTTCAGG + Intergenic
1200903036 Y:8452294-8452316 TGTCACAATTCCTCTTCTTAGGG - Intergenic