ID: 1054579909

View in Genome Browser
Species Human (GRCh38)
Location 9:66901652-66901674
Sequence TCAGAATTTTTGGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054579906_1054579909 11 Left 1054579906 9:66901618-66901640 CCAATAGAAAGATAAGGCAAAAC 0: 2
1: 0
2: 1
3: 42
4: 385
Right 1054579909 9:66901652-66901674 TCAGAATTTTTGGCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054579909 Original CRISPR TCAGAATTTTTGGCCAGGTG CGG Intronic
No off target data available for this crispr