ID: 1054579909 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:66901652-66901674 |
Sequence | TCAGAATTTTTGGCCAGGTG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1054579906_1054579909 | 11 | Left | 1054579906 | 9:66901618-66901640 | CCAATAGAAAGATAAGGCAAAAC | 0: 2 1: 0 2: 1 3: 42 4: 385 |
||
Right | 1054579909 | 9:66901652-66901674 | TCAGAATTTTTGGCCAGGTGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1054579909 | Original CRISPR | TCAGAATTTTTGGCCAGGTG CGG | Intronic | ||
No off target data available for this crispr |