ID: 1054588272

View in Genome Browser
Species Human (GRCh38)
Location 9:66987732-66987754
Sequence CAGCTGGACAGGAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054588272_1054588280 -8 Left 1054588272 9:66987732-66987754 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1054588280 9:66987747-66987769 TCCAGCTGGAGGAGGCTTCAAGG No data
1054588272_1054588282 -7 Left 1054588272 9:66987732-66987754 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1054588282 9:66987748-66987770 CCAGCTGGAGGAGGCTTCAAGGG No data
1054588272_1054588283 14 Left 1054588272 9:66987732-66987754 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1054588283 9:66987769-66987791 GGTTCATGATCATTCCAAGATGG No data
1054588272_1054588285 26 Left 1054588272 9:66987732-66987754 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1054588285 9:66987781-66987803 TTCCAAGATGGGATTCCTCGCGG No data
1054588272_1054588284 15 Left 1054588272 9:66987732-66987754 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1054588284 9:66987770-66987792 GTTCATGATCATTCCAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054588272 Original CRISPR CAGCTGGACAGGAGGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr