ID: 1054604286 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:67159376-67159398 |
Sequence | CCTTCTGTACTAAAGGAAGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1054604286_1054604289 | -8 | Left | 1054604286 | 9:67159376-67159398 | CCATCTTCCTTTAGTACAGAAGG | No data | ||
Right | 1054604289 | 9:67159391-67159413 | ACAGAAGGCATATTTGTGCCAGG | 0: 2 1: 0 2: 2 3: 14 4: 206 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1054604286 | Original CRISPR | CCTTCTGTACTAAAGGAAGA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |