ID: 1054604286

View in Genome Browser
Species Human (GRCh38)
Location 9:67159376-67159398
Sequence CCTTCTGTACTAAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054604286_1054604289 -8 Left 1054604286 9:67159376-67159398 CCATCTTCCTTTAGTACAGAAGG No data
Right 1054604289 9:67159391-67159413 ACAGAAGGCATATTTGTGCCAGG 0: 2
1: 0
2: 2
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054604286 Original CRISPR CCTTCTGTACTAAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr