ID: 1054606685

View in Genome Browser
Species Human (GRCh38)
Location 9:67187970-67187992
Sequence CTGAAGTTCTCTAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054606685_1054606687 13 Left 1054606685 9:67187970-67187992 CCTTCTTTCCTAGAGAACTTCAG No data
Right 1054606687 9:67188006-67188028 TCTTACAGCCTTCAACTGATTGG 0: 4
1: 15
2: 101
3: 316
4: 656
1054606685_1054606688 19 Left 1054606685 9:67187970-67187992 CCTTCTTTCCTAGAGAACTTCAG No data
Right 1054606688 9:67188012-67188034 AGCCTTCAACTGATTGGATGAGG 0: 32
1: 235
2: 564
3: 821
4: 1049

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054606685 Original CRISPR CTGAAGTTCTCTAGGAAAGA AGG (reversed) Intergenic
No off target data available for this crispr