ID: 1054614845

View in Genome Browser
Species Human (GRCh38)
Location 9:67281486-67281508
Sequence CTTCTCATGGGACATCTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054614841_1054614845 22 Left 1054614841 9:67281441-67281463 CCTTTGCTTCCTTATCATTAAAA No data
Right 1054614845 9:67281486-67281508 CTTCTCATGGGACATCTAATAGG No data
1054614842_1054614845 13 Left 1054614842 9:67281450-67281472 CCTTATCATTAAAATTGTACTTT No data
Right 1054614845 9:67281486-67281508 CTTCTCATGGGACATCTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054614845 Original CRISPR CTTCTCATGGGACATCTAAT AGG Intergenic
No off target data available for this crispr