ID: 1054621575

View in Genome Browser
Species Human (GRCh38)
Location 9:67354302-67354324
Sequence AGAATATCCCCTATGAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054621575_1054621582 12 Left 1054621575 9:67354302-67354324 CCTGAGTTCATAGGGGATATTCT No data
Right 1054621582 9:67354337-67354359 GCCCAGAACCTGAGTTTATGAGG No data
1054621575_1054621580 -10 Left 1054621575 9:67354302-67354324 CCTGAGTTCATAGGGGATATTCT No data
Right 1054621580 9:67354315-67354337 GGGATATTCTGGTACCGGGCGGG No data
1054621575_1054621586 17 Left 1054621575 9:67354302-67354324 CCTGAGTTCATAGGGGATATTCT No data
Right 1054621586 9:67354342-67354364 GAACCTGAGTTTATGAGGCTGGG No data
1054621575_1054621585 16 Left 1054621575 9:67354302-67354324 CCTGAGTTCATAGGGGATATTCT No data
Right 1054621585 9:67354341-67354363 AGAACCTGAGTTTATGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054621575 Original CRISPR AGAATATCCCCTATGAACTC AGG (reversed) Intergenic
No off target data available for this crispr