ID: 1054621692

View in Genome Browser
Species Human (GRCh38)
Location 9:67354872-67354894
Sequence ATGAAGGTGGATCTGTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054621686_1054621692 13 Left 1054621686 9:67354836-67354858 CCTGATTTCATGGGAACAGGTCT No data
Right 1054621692 9:67354872-67354894 ATGAAGGTGGATCTGTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054621692 Original CRISPR ATGAAGGTGGATCTGTAGCC TGG Intergenic
No off target data available for this crispr