ID: 1054628860

View in Genome Browser
Species Human (GRCh38)
Location 9:67425813-67425835
Sequence AGGGGCTCCCAGATTCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054628854_1054628860 19 Left 1054628854 9:67425771-67425793 CCTCTGCTCTCACTTTTTTATGT No data
Right 1054628860 9:67425813-67425835 AGGGGCTCCCAGATTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054628860 Original CRISPR AGGGGCTCCCAGATTCCTCA TGG Intergenic
No off target data available for this crispr