ID: 1054634659

View in Genome Browser
Species Human (GRCh38)
Location 9:67477413-67477435
Sequence CTAGGATAAAGGCATTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054634659_1054634672 23 Left 1054634659 9:67477413-67477435 CCCCCCAAATGCCTTTATCCTAG No data
Right 1054634672 9:67477459-67477481 CCTAGGATAAAGTAGTACACAGG No data
1054634659_1054634667 6 Left 1054634659 9:67477413-67477435 CCCCCCAAATGCCTTTATCCTAG No data
Right 1054634667 9:67477442-67477464 TGATGTTCCCCAAAATGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054634659 Original CRISPR CTAGGATAAAGGCATTTGGG GGG (reversed) Intergenic