ID: 1054634665 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:67477424-67477446 |
Sequence | CATCAAAATGCCTAGGATAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1054634665_1054634667 | -5 | Left | 1054634665 | 9:67477424-67477446 | CCTTTATCCTAGGCATTTTGATG | No data | ||
Right | 1054634667 | 9:67477442-67477464 | TGATGTTCCCCAAAATGCCTAGG | No data | ||||
1054634665_1054634672 | 12 | Left | 1054634665 | 9:67477424-67477446 | CCTTTATCCTAGGCATTTTGATG | No data | ||
Right | 1054634672 | 9:67477459-67477481 | CCTAGGATAAAGTAGTACACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1054634665 | Original CRISPR | CATCAAAATGCCTAGGATAA AGG (reversed) | Intergenic | ||