ID: 1054634665

View in Genome Browser
Species Human (GRCh38)
Location 9:67477424-67477446
Sequence CATCAAAATGCCTAGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054634665_1054634667 -5 Left 1054634665 9:67477424-67477446 CCTTTATCCTAGGCATTTTGATG No data
Right 1054634667 9:67477442-67477464 TGATGTTCCCCAAAATGCCTAGG No data
1054634665_1054634672 12 Left 1054634665 9:67477424-67477446 CCTTTATCCTAGGCATTTTGATG No data
Right 1054634672 9:67477459-67477481 CCTAGGATAAAGTAGTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054634665 Original CRISPR CATCAAAATGCCTAGGATAA AGG (reversed) Intergenic