ID: 1054634666

View in Genome Browser
Species Human (GRCh38)
Location 9:67477431-67477453
Sequence TGGGGAACATCAAAATGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054634666_1054634672 5 Left 1054634666 9:67477431-67477453 CCTAGGCATTTTGATGTTCCCCA No data
Right 1054634672 9:67477459-67477481 CCTAGGATAAAGTAGTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054634666 Original CRISPR TGGGGAACATCAAAATGCCT AGG (reversed) Intergenic