ID: 1054634667

View in Genome Browser
Species Human (GRCh38)
Location 9:67477442-67477464
Sequence TGATGTTCCCCAAAATGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054634660_1054634667 5 Left 1054634660 9:67477414-67477436 CCCCCAAATGCCTTTATCCTAGG No data
Right 1054634667 9:67477442-67477464 TGATGTTCCCCAAAATGCCTAGG No data
1054634662_1054634667 4 Left 1054634662 9:67477415-67477437 CCCCAAATGCCTTTATCCTAGGC No data
Right 1054634667 9:67477442-67477464 TGATGTTCCCCAAAATGCCTAGG No data
1054634665_1054634667 -5 Left 1054634665 9:67477424-67477446 CCTTTATCCTAGGCATTTTGATG No data
Right 1054634667 9:67477442-67477464 TGATGTTCCCCAAAATGCCTAGG No data
1054634658_1054634667 24 Left 1054634658 9:67477395-67477417 CCAATGCTTTTTTGATGGCCCCC No data
Right 1054634667 9:67477442-67477464 TGATGTTCCCCAAAATGCCTAGG No data
1054634663_1054634667 3 Left 1054634663 9:67477416-67477438 CCCAAATGCCTTTATCCTAGGCA No data
Right 1054634667 9:67477442-67477464 TGATGTTCCCCAAAATGCCTAGG No data
1054634659_1054634667 6 Left 1054634659 9:67477413-67477435 CCCCCCAAATGCCTTTATCCTAG No data
Right 1054634667 9:67477442-67477464 TGATGTTCCCCAAAATGCCTAGG No data
1054634664_1054634667 2 Left 1054634664 9:67477417-67477439 CCAAATGCCTTTATCCTAGGCAT No data
Right 1054634667 9:67477442-67477464 TGATGTTCCCCAAAATGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054634667 Original CRISPR TGATGTTCCCCAAAATGCCT AGG Intergenic