ID: 1054634672

View in Genome Browser
Species Human (GRCh38)
Location 9:67477459-67477481
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054634660_1054634672 22 Left 1054634660 9:67477414-67477436 CCCCCAAATGCCTTTATCCTAGG No data
Right 1054634672 9:67477459-67477481 CCTAGGATAAAGTAGTACACAGG No data
1054634664_1054634672 19 Left 1054634664 9:67477417-67477439 CCAAATGCCTTTATCCTAGGCAT No data
Right 1054634672 9:67477459-67477481 CCTAGGATAAAGTAGTACACAGG No data
1054634665_1054634672 12 Left 1054634665 9:67477424-67477446 CCTTTATCCTAGGCATTTTGATG No data
Right 1054634672 9:67477459-67477481 CCTAGGATAAAGTAGTACACAGG No data
1054634662_1054634672 21 Left 1054634662 9:67477415-67477437 CCCCAAATGCCTTTATCCTAGGC No data
Right 1054634672 9:67477459-67477481 CCTAGGATAAAGTAGTACACAGG No data
1054634659_1054634672 23 Left 1054634659 9:67477413-67477435 CCCCCCAAATGCCTTTATCCTAG No data
Right 1054634672 9:67477459-67477481 CCTAGGATAAAGTAGTACACAGG No data
1054634663_1054634672 20 Left 1054634663 9:67477416-67477438 CCCAAATGCCTTTATCCTAGGCA No data
Right 1054634672 9:67477459-67477481 CCTAGGATAAAGTAGTACACAGG No data
1054634666_1054634672 5 Left 1054634666 9:67477431-67477453 CCTAGGCATTTTGATGTTCCCCA No data
Right 1054634672 9:67477459-67477481 CCTAGGATAAAGTAGTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054634672 Original CRISPR CCTAGGATAAAGTAGTACAC AGG Intergenic
No off target data available for this crispr