ID: 1054635284

View in Genome Browser
Species Human (GRCh38)
Location 9:67484519-67484541
Sequence TGCCAGTGCAAAATTGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054635284_1054635292 6 Left 1054635284 9:67484519-67484541 CCATGTCCAATTTTGCACTGGCA No data
Right 1054635292 9:67484548-67484570 TTGGCACAGGGGCAGGGTGCTGG 0: 4
1: 5
2: 27
3: 88
4: 451
1054635284_1054635290 -1 Left 1054635284 9:67484519-67484541 CCATGTCCAATTTTGCACTGGCA No data
Right 1054635290 9:67484541-67484563 AGCAGTGTTGGCACAGGGGCAGG No data
1054635284_1054635288 -6 Left 1054635284 9:67484519-67484541 CCATGTCCAATTTTGCACTGGCA No data
Right 1054635288 9:67484536-67484558 CTGGCAGCAGTGTTGGCACAGGG No data
1054635284_1054635296 17 Left 1054635284 9:67484519-67484541 CCATGTCCAATTTTGCACTGGCA No data
Right 1054635296 9:67484559-67484581 GCAGGGTGCTGGTGGAGGGAAGG No data
1054635284_1054635293 9 Left 1054635284 9:67484519-67484541 CCATGTCCAATTTTGCACTGGCA No data
Right 1054635293 9:67484551-67484573 GCACAGGGGCAGGGTGCTGGTGG No data
1054635284_1054635297 25 Left 1054635284 9:67484519-67484541 CCATGTCCAATTTTGCACTGGCA No data
Right 1054635297 9:67484567-67484589 CTGGTGGAGGGAAGGCTCATAGG No data
1054635284_1054635289 -5 Left 1054635284 9:67484519-67484541 CCATGTCCAATTTTGCACTGGCA No data
Right 1054635289 9:67484537-67484559 TGGCAGCAGTGTTGGCACAGGGG No data
1054635284_1054635287 -7 Left 1054635284 9:67484519-67484541 CCATGTCCAATTTTGCACTGGCA No data
Right 1054635287 9:67484535-67484557 ACTGGCAGCAGTGTTGGCACAGG No data
1054635284_1054635294 12 Left 1054635284 9:67484519-67484541 CCATGTCCAATTTTGCACTGGCA No data
Right 1054635294 9:67484554-67484576 CAGGGGCAGGGTGCTGGTGGAGG No data
1054635284_1054635295 13 Left 1054635284 9:67484519-67484541 CCATGTCCAATTTTGCACTGGCA No data
Right 1054635295 9:67484555-67484577 AGGGGCAGGGTGCTGGTGGAGGG No data
1054635284_1054635291 0 Left 1054635284 9:67484519-67484541 CCATGTCCAATTTTGCACTGGCA No data
Right 1054635291 9:67484542-67484564 GCAGTGTTGGCACAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054635284 Original CRISPR TGCCAGTGCAAAATTGGACA TGG (reversed) Intergenic
No off target data available for this crispr