ID: 1054636110

View in Genome Browser
Species Human (GRCh38)
Location 9:67492656-67492678
Sequence CTGAGTATTATCTACAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054636110_1054636114 25 Left 1054636110 9:67492656-67492678 CCTAACTTGTAGATAATACTCAG No data
Right 1054636114 9:67492704-67492726 ACATCCTGCATCTAACTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054636110 Original CRISPR CTGAGTATTATCTACAAGTT AGG (reversed) Intergenic
No off target data available for this crispr