ID: 1054636112

View in Genome Browser
Species Human (GRCh38)
Location 9:67492690-67492712
Sequence GCAGGATGTGATGTATTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054636112_1054636117 19 Left 1054636112 9:67492690-67492712 CCCTAAAATACATCACATCCTGC No data
Right 1054636117 9:67492732-67492754 CATACATCATCTAACTTGTGAGG No data
1054636112_1054636114 -9 Left 1054636112 9:67492690-67492712 CCCTAAAATACATCACATCCTGC No data
Right 1054636114 9:67492704-67492726 ACATCCTGCATCTAACTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054636112 Original CRISPR GCAGGATGTGATGTATTTTA GGG (reversed) Intergenic
No off target data available for this crispr