ID: 1054636114

View in Genome Browser
Species Human (GRCh38)
Location 9:67492704-67492726
Sequence ACATCCTGCATCTAACTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054636113_1054636114 -10 Left 1054636113 9:67492691-67492713 CCTAAAATACATCACATCCTGCA No data
Right 1054636114 9:67492704-67492726 ACATCCTGCATCTAACTAAGTGG No data
1054636110_1054636114 25 Left 1054636110 9:67492656-67492678 CCTAACTTGTAGATAATACTCAG No data
Right 1054636114 9:67492704-67492726 ACATCCTGCATCTAACTAAGTGG No data
1054636112_1054636114 -9 Left 1054636112 9:67492690-67492712 CCCTAAAATACATCACATCCTGC No data
Right 1054636114 9:67492704-67492726 ACATCCTGCATCTAACTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054636114 Original CRISPR ACATCCTGCATCTAACTAAG TGG Intergenic
No off target data available for this crispr