ID: 1054636117

View in Genome Browser
Species Human (GRCh38)
Location 9:67492732-67492754
Sequence CATACATCATCTAACTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054636115_1054636117 1 Left 1054636115 9:67492708-67492730 CCTGCATCTAACTAAGTGGTTTT No data
Right 1054636117 9:67492732-67492754 CATACATCATCTAACTTGTGAGG No data
1054636112_1054636117 19 Left 1054636112 9:67492690-67492712 CCCTAAAATACATCACATCCTGC No data
Right 1054636117 9:67492732-67492754 CATACATCATCTAACTTGTGAGG No data
1054636113_1054636117 18 Left 1054636113 9:67492691-67492713 CCTAAAATACATCACATCCTGCA No data
Right 1054636117 9:67492732-67492754 CATACATCATCTAACTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054636117 Original CRISPR CATACATCATCTAACTTGTG AGG Intergenic
No off target data available for this crispr