ID: 1054637341

View in Genome Browser
Species Human (GRCh38)
Location 9:67506852-67506874
Sequence ATGAAGAAGCCAACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054637341_1054637346 14 Left 1054637341 9:67506852-67506874 CCTTCCTCAGTTGGCTTCTTCAT No data
Right 1054637346 9:67506889-67506911 CCTCCTTTCATGGAAACCGTTGG No data
1054637341_1054637343 4 Left 1054637341 9:67506852-67506874 CCTTCCTCAGTTGGCTTCTTCAT No data
Right 1054637343 9:67506879-67506901 GTGACCACATCCTCCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054637341 Original CRISPR ATGAAGAAGCCAACTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr