ID: 1054638249

View in Genome Browser
Species Human (GRCh38)
Location 9:67515989-67516011
Sequence CAGTGCTAAAACAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054638244_1054638249 -4 Left 1054638244 9:67515970-67515992 CCATAAACTCAGTATCAACCAGT No data
Right 1054638249 9:67515989-67516011 CAGTGCTAAAACAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054638249 Original CRISPR CAGTGCTAAAACAGGGAAGA GGG Intergenic
No off target data available for this crispr