ID: 1054640240

View in Genome Browser
Species Human (GRCh38)
Location 9:67533816-67533838
Sequence CTTTAAAAACAGAAGAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054640240_1054640242 29 Left 1054640240 9:67533816-67533838 CCCAGATTCTTCTGTTTTTAAAG No data
Right 1054640242 9:67533868-67533890 TTTTTTCAGAAATGAAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054640240 Original CRISPR CTTTAAAAACAGAAGAATCT GGG (reversed) Intergenic
No off target data available for this crispr