ID: 1054642954

View in Genome Browser
Species Human (GRCh38)
Location 9:67561088-67561110
Sequence GAGTGGAAGCAGCATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054642944_1054642954 3 Left 1054642944 9:67561062-67561084 CCCACACCCCATCCACTTTCTGC No data
Right 1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG No data
1054642950_1054642954 -9 Left 1054642950 9:67561074-67561096 CCACTTTCTGCCATGAGTGGAAG 0: 7
1: 19
2: 55
3: 179
4: 499
Right 1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG No data
1054642945_1054642954 2 Left 1054642945 9:67561063-67561085 CCACACCCCATCCACTTTCTGCC No data
Right 1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG No data
1054642946_1054642954 -3 Left 1054642946 9:67561068-67561090 CCCCATCCACTTTCTGCCATGAG No data
Right 1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG No data
1054642948_1054642954 -5 Left 1054642948 9:67561070-67561092 CCATCCACTTTCTGCCATGAGTG No data
Right 1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG No data
1054642947_1054642954 -4 Left 1054642947 9:67561069-67561091 CCCATCCACTTTCTGCCATGAGT No data
Right 1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG No data
1054642943_1054642954 25 Left 1054642943 9:67561040-67561062 CCACGTGATCTCTTTGCACACGC No data
Right 1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054642954 Original CRISPR GAGTGGAAGCAGCATGAGGG AGG Intergenic
No off target data available for this crispr