ID: 1054647370

View in Genome Browser
Species Human (GRCh38)
Location 9:67602081-67602103
Sequence CCTCACCAGAAGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054647370_1054647377 -8 Left 1054647370 9:67602081-67602103 CCCTCCCCCTTCTTCTGGTGAGG No data
Right 1054647377 9:67602096-67602118 TGGTGAGGCCAGAAGTACCTAGG No data
1054647370_1054647378 -4 Left 1054647370 9:67602081-67602103 CCCTCCCCCTTCTTCTGGTGAGG No data
Right 1054647378 9:67602100-67602122 GAGGCCAGAAGTACCTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054647370 Original CRISPR CCTCACCAGAAGAAGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr