ID: 1054648013

View in Genome Browser
Species Human (GRCh38)
Location 9:67605452-67605474
Sequence CTGTTCCGGCCAGAAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054648013_1054648018 11 Left 1054648013 9:67605452-67605474 CCAGCACCTTCTGGCCGGAACAG No data
Right 1054648018 9:67605486-67605508 AAATAAACGAGTAACAAAAATGG No data
1054648013_1054648019 12 Left 1054648013 9:67605452-67605474 CCAGCACCTTCTGGCCGGAACAG No data
Right 1054648019 9:67605487-67605509 AATAAACGAGTAACAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054648013 Original CRISPR CTGTTCCGGCCAGAAGGTGC TGG (reversed) Intergenic
No off target data available for this crispr