ID: 1054649188

View in Genome Browser
Species Human (GRCh38)
Location 9:67612387-67612409
Sequence TCAAGTGGCCGCCTTCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054649188_1054649196 20 Left 1054649188 9:67612387-67612409 CCTCTGTGAAGGCGGCCACTTGA No data
Right 1054649196 9:67612430-67612452 TGTCACACCCGGCAGTGCACAGG No data
1054649188_1054649194 9 Left 1054649188 9:67612387-67612409 CCTCTGTGAAGGCGGCCACTTGA No data
Right 1054649194 9:67612419-67612441 CCAGGAGCCTCTGTCACACCCGG No data
1054649188_1054649191 -9 Left 1054649188 9:67612387-67612409 CCTCTGTGAAGGCGGCCACTTGA No data
Right 1054649191 9:67612401-67612423 GCCACTTGAGGCAGGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054649188 Original CRISPR TCAAGTGGCCGCCTTCACAG AGG (reversed) Intergenic
No off target data available for this crispr