ID: 1054649747

View in Genome Browser
Species Human (GRCh38)
Location 9:67616393-67616415
Sequence AAACCCATGCTGCTTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054649744_1054649747 -4 Left 1054649744 9:67616374-67616396 CCACCTACCATGTGAGTGGAAAC No data
Right 1054649747 9:67616393-67616415 AAACCCATGCTGCTTCTGCCTGG No data
1054649745_1054649747 -7 Left 1054649745 9:67616377-67616399 CCTACCATGTGAGTGGAAACCCA No data
Right 1054649747 9:67616393-67616415 AAACCCATGCTGCTTCTGCCTGG No data
1054649742_1054649747 14 Left 1054649742 9:67616356-67616378 CCAGACGAAATTGCACAGCCACC No data
Right 1054649747 9:67616393-67616415 AAACCCATGCTGCTTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054649747 Original CRISPR AAACCCATGCTGCTTCTGCC TGG Intergenic
No off target data available for this crispr