ID: 1054653778

View in Genome Browser
Species Human (GRCh38)
Location 9:67646275-67646297
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 6, 1: 3, 2: 1, 3: 24, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054653778_1054653785 28 Left 1054653778 9:67646275-67646297 CCAGGCTCCATCTTTGCAAAACT 0: 6
1: 3
2: 1
3: 24
4: 258
Right 1054653785 9:67646326-67646348 CTAGCAATTCTGGAGGATCAGGG No data
1054653778_1054653783 21 Left 1054653778 9:67646275-67646297 CCAGGCTCCATCTTTGCAAAACT 0: 6
1: 3
2: 1
3: 24
4: 258
Right 1054653783 9:67646319-67646341 TTTCTAACTAGCAATTCTGGAGG 0: 9
1: 0
2: 2
3: 18
4: 314
1054653778_1054653782 18 Left 1054653778 9:67646275-67646297 CCAGGCTCCATCTTTGCAAAACT 0: 6
1: 3
2: 1
3: 24
4: 258
Right 1054653782 9:67646316-67646338 ACGTTTCTAACTAGCAATTCTGG 0: 9
1: 1
2: 0
3: 6
4: 55
1054653778_1054653784 27 Left 1054653778 9:67646275-67646297 CCAGGCTCCATCTTTGCAAAACT 0: 6
1: 3
2: 1
3: 24
4: 258
Right 1054653784 9:67646325-67646347 ACTAGCAATTCTGGAGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054653778 Original CRISPR AGTTTTGCAAAGATGGAGCC TGG (reversed) Intergenic
900755031 1:4428637-4428659 AGTTATGCAAAGTAGGGGCCTGG + Intergenic
901280328 1:8028324-8028346 AGGTTTGAAAAGATGTACCCTGG - Intergenic
901425792 1:9181954-9181976 AAGTTTGCAAAGAAGGAGGCGGG - Intergenic
903028260 1:20444673-20444695 AGTTGTGTAGAGGTGGAGCCAGG - Intergenic
903046147 1:20565767-20565789 AGATTTGAAATGATGGAGCCAGG + Intergenic
903333859 1:22612122-22612144 GGTTCTGCAAAGATCTAGCCTGG - Intergenic
904032785 1:27543545-27543567 AGGTTTGCACACATGGAGACCGG - Intronic
904118872 1:28182494-28182516 GTTTTTGTAAAGATGGAGTCTGG - Intronic
904525762 1:31132716-31132738 AAAATTGCAAAGATGCAGCCAGG + Intergenic
905434017 1:37944757-37944779 TTTTTTGTAGAGATGGAGCCGGG + Intronic
905687853 1:39921712-39921734 AGTTGCGCAAAGCTGGAGTCAGG - Intergenic
907258205 1:53196518-53196540 AGTCTCGCAAGGATGGAGCCTGG + Exonic
907597708 1:55734954-55734976 ATTTTTACAAAGATGGAGAGAGG - Intergenic
908956639 1:69637966-69637988 AGTTTTGCAAAGAGAGAGAAAGG + Intronic
910685825 1:89914927-89914949 AGTTTGGAAAAGACGGAGCATGG - Intronic
911348403 1:96722750-96722772 AGGTTCGCAAAGATGCAGCATGG - Intronic
912555786 1:110514969-110514991 AGTCATGCAAAGATCCAGCCTGG - Intergenic
914753434 1:150550360-150550382 ACTTTTCCAGAGAGGGAGCCAGG + Intronic
915757206 1:158273685-158273707 ATCTTTTAAAAGATGGAGCCAGG - Intergenic
915924607 1:160006267-160006289 ATTTTTGTAGAGATGGAGTCTGG + Intergenic
920575231 1:207054196-207054218 AGTTTTGCAAACAGTGAGGCCGG - Intronic
921400341 1:214715180-214715202 ATTTTTGCAAAGCTGTAGCCAGG - Intergenic
921495188 1:215830501-215830523 AGTTATGCAAATTTGGAGGCAGG + Intronic
921676197 1:217979114-217979136 AGTTCTCCAAAGATTGACCCTGG + Intergenic
922596484 1:226817538-226817560 AGCTTTGTAAAGCGGGAGCCTGG + Intergenic
923205011 1:231750593-231750615 AGTTATTCAAACATGCAGCCAGG - Intronic
1063421894 10:5919095-5919117 AGATTTGCAAAAATGGAACATGG + Intronic
1064402920 10:15036200-15036222 TATTTTTTAAAGATGGAGCCAGG + Intronic
1072953819 10:99871541-99871563 TCTTTTGCACAGATGGTGCCAGG - Intergenic
1074435682 10:113432302-113432324 TCTTATGCAGAGATGGAGCCAGG - Intergenic
1074871990 10:117584246-117584268 AGCTTTGAAGTGATGGAGCCGGG + Intergenic
1075425159 10:122336420-122336442 AGTTAGGGAAAGCTGGAGCCTGG - Intronic
1076198323 10:128537208-128537230 ATTTTTGCAAAGATGTTGCTTGG + Intergenic
1076508932 10:130998622-130998644 AGTGTTGCCCAGATTGAGCCGGG - Intergenic
1076825254 10:132963948-132963970 AGGCTTGCAAAGATGGAGGTGGG - Intergenic
1077641807 11:3888091-3888113 TGTTTTTGAAAGATGAAGCCTGG + Intronic
1078999911 11:16743101-16743123 TGTTTTGCAATTATGGAGCAAGG - Intronic
1079539774 11:21559329-21559351 AGTTATCCAAAGGTGGAGTCAGG + Intronic
1079963686 11:26954333-26954355 AGTTTTGCACAGATGCAACGGGG + Intergenic
1080621134 11:33988070-33988092 AGTTTTGCAGAGAAGGAGGTAGG - Intergenic
1083359157 11:62093482-62093504 GGTTTTGCAATGTTGGAGGCTGG - Intergenic
1083360294 11:62102538-62102560 GGTTTTGCAATGTTGGAGGCTGG + Intergenic
1085571952 11:77567762-77567784 AGTTTTGCTAAGAGACAGCCGGG + Intronic
1085715480 11:78869321-78869343 GGTTTTGCAGAGATGCAGTCAGG - Intronic
1087207807 11:95415877-95415899 TGTTTTGCAAAAATGGAGACTGG + Intergenic
1087860680 11:103150714-103150736 AATTTTGCAAAGTTCAAGCCTGG - Intronic
1088784745 11:113171163-113171185 CATTTTGCAAAGATGGAAACAGG + Intronic
1088800715 11:113304783-113304805 ATTTTTGCAATGATGTAACCAGG - Intergenic
1089124854 11:116169685-116169707 AGCTTTGCAGAGATGGAGAGGGG - Intergenic
1090646297 11:128768991-128769013 AATTTTGGAAAGGTGGAACCTGG - Intronic
1091109948 11:132956812-132956834 AGTTTTACAAAGATAGAGTCAGG + Intronic
1093955022 12:25207050-25207072 AGTTTTGCAAAGAAGGGGTTTGG - Intronic
1095053905 12:37578320-37578342 AGTTTTACAAAGATGGAGCCTGG - Intergenic
1095122685 12:38437686-38437708 AGTTTGGAAAACATGCAGCCTGG - Intergenic
1097708390 12:62892462-62892484 ATTTTTGCAAAGAAGCAACCAGG - Intronic
1097882695 12:64700438-64700460 ATTTTTGTAAAGATGGAGTCAGG + Intergenic
1098189478 12:67932825-67932847 AGTATTGATAAGATGGAGGCTGG + Intergenic
1099859156 12:88206604-88206626 AGTTTTGAAAATTTGCAGCCTGG - Intergenic
1102997369 12:117360919-117360941 GGTCTTGCAAAGTTGGAGCCTGG + Intronic
1103322522 12:120100297-120100319 AGCCTTTCAGAGATGGAGCCAGG - Intronic
1103679608 12:122682840-122682862 TGTTTTAGAAAGATGGAGCTGGG + Intergenic
1104658083 12:130588932-130588954 GGATTTGCAAAGATGGAATCAGG + Intronic
1105005386 12:132717988-132718010 AGTATTACGAAGACGGAGCCCGG + Exonic
1106987782 13:35375642-35375664 AGTTTTGCAAAAATCCAGCAAGG + Intronic
1108067445 13:46592770-46592792 AGTTTTGCCCAGAAGCAGCCAGG - Intronic
1110163140 13:72403407-72403429 AGTTTTGCAAAGATAAAGGAAGG - Intergenic
1110494522 13:76150649-76150671 AGTTTTTAAATGATGGAGTCAGG + Intergenic
1113292360 13:108921030-108921052 GGTTTTGGAAAGAAGGAGACAGG - Intronic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114602129 14:23965528-23965550 AGGTGAGCAAAAATGGAGCCTGG - Intronic
1114606298 14:24000629-24000651 AGGTGAGCAAAAATGGAGCCTGG - Intronic
1114611850 14:24047924-24047946 AGGTGAGCAAAAATGGAGCCTGG - Intergenic
1117131030 14:52687086-52687108 AGTCTGGCAAAGATGGTGGCAGG + Intronic
1119788305 14:77328672-77328694 AGGGGTGCCAAGATGGAGCCAGG + Intronic
1120977080 14:90258127-90258149 AGCTTGTCAGAGATGGAGCCAGG - Intronic
1202833938 14_GL000009v2_random:63980-64002 AGTTTGGAAAATGTGGAGCCTGG + Intergenic
1124620920 15:31273480-31273502 GGTTTTGTGAAGATGAAGCCGGG - Intergenic
1124645609 15:31436015-31436037 AGTTTGGCAAACACTGAGCCGGG + Intergenic
1125482447 15:40089884-40089906 TGCTTTGCAGAGAAGGAGCCGGG - Exonic
1128352711 15:66901740-66901762 AATATTTCAAAGAGGGAGCCAGG - Intergenic
1129950237 15:79580617-79580639 AGTTTTGCAATGTTTGAGACGGG - Intergenic
1130569901 15:85033113-85033135 AGTTCTTCAAAGATTGAACCAGG + Intronic
1132808675 16:1787492-1787514 AGGAGTGCAAAGATGGGGCCGGG - Intronic
1134094566 16:11411076-11411098 TGTTTGGGAAAGCTGGAGCCAGG + Intronic
1134660116 16:15977595-15977617 AGATTTGCCAACATGGAGACAGG - Intronic
1134859868 16:17551572-17551594 AGTGTGACAAAGATGGACCCAGG - Intergenic
1135176443 16:20233915-20233937 AGATCTGCAAAGAGGGTGCCAGG - Intergenic
1135248999 16:20884346-20884368 AGTTTTGCAAAGCTAGAGTGGGG - Intronic
1137963180 16:52906248-52906270 AGTTTTGGAATGATAGAGCTGGG - Intergenic
1138984696 16:62314260-62314282 AGGTTTACAGAGATGGAGCCAGG + Intergenic
1140676585 16:77338197-77338219 ATGTATGAAAAGATGGAGCCAGG - Intronic
1140743725 16:77963281-77963303 GGTTTTTCAAAGAGGGAGGCAGG + Intronic
1141789324 16:86223696-86223718 ACCTCTGCAAAGATGGAGCCAGG - Intergenic
1142326624 16:89419758-89419780 CGTTTTGCAAAGATGGAGTGAGG + Intronic
1142979439 17:3663237-3663259 AGCTTTGCCCAGATGAAGCCAGG - Exonic
1143551576 17:7633585-7633607 AGTTGTGAAAACATGGAGACTGG + Intergenic
1145042124 17:19584781-19584803 ATTTTTGTAAAGATGGGGTCTGG + Intergenic
1145374439 17:22334383-22334405 AGATTTGCAAAGATGGAGCCTGG - Intergenic
1145756762 17:27397713-27397735 AGTATTGAAAAGATGGAGGCTGG + Intergenic
1147601832 17:41751391-41751413 TGATTTGTAAAGATGGAGTCTGG - Intergenic
1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG + Intronic
1148351006 17:46942326-46942348 AGATTGGCAGGGATGGAGCCAGG - Intronic
1149954409 17:61032409-61032431 AGTTTTGGGAAGATGGTGGCTGG - Intronic
1150062561 17:62081505-62081527 AGTTTTGAATGGATGCAGCCTGG - Intergenic
1150408390 17:64921720-64921742 ACTTTGGGAAAGAAGGAGCCGGG + Intergenic
1152490159 17:80625886-80625908 AGATTTGCACAGCTGGAGACGGG - Intronic
1153423915 18:4941854-4941876 AACTTGGCAGAGATGGAGCCAGG - Intergenic
1153460134 18:5324087-5324109 AGGTATGAAAAGATGAAGCCTGG + Intergenic
1153667102 18:7376085-7376107 AGACTTGCAAAGATGGGACCTGG - Intergenic
1154431121 18:14309410-14309432 AGTTTGGCAAATTTGCAGCCCGG + Intergenic
1154433797 18:14328718-14328740 AGTTTGGCAAATTTGCAGCCCGG + Intergenic
1155137749 18:23013284-23013306 AGTTTGGCAGAGAGGGAGCTGGG + Intronic
1155152420 18:23133981-23134003 CCTTTTGAAAACATGGAGCCTGG - Intergenic
1155578388 18:27275181-27275203 AATTTTGCCAAGATAGAGGCAGG + Intergenic
1156154773 18:34288262-34288284 AGTTTTGAAAACGTGCAGCCTGG - Intergenic
1157562623 18:48659518-48659540 AGCTGTGCAAAGATGGGGTCCGG + Intronic
1157847428 18:51017137-51017159 AGATTTGTAAAGATGGAGGCAGG + Intronic
1158023846 18:52872418-52872440 AGATTTGCACTGATGGAGCTGGG - Intronic
1160162082 18:76481033-76481055 AGTTTTGCAAATACAGACCCAGG + Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1162004128 19:7766439-7766461 AGTCTGGAAGAGATGGAGCCAGG + Intronic
1163779150 19:19237098-19237120 AGTTTAGTAGAGATGGGGCCAGG + Intronic
1164478351 19:28592302-28592324 ATCTTTGGAAGGATGGAGCCTGG - Intergenic
1164827122 19:31291956-31291978 AGTCTTGCAAAAATGCACCCTGG - Intronic
1164965783 19:32481591-32481613 TTTTTTGTAAAGATGGAGTCTGG + Intronic
1166797577 19:45436646-45436668 AGTTTTGTAGAGATGAAGCGGGG + Intronic
1167686322 19:50958983-50959005 AGTGATGCAAGGATGGAGCTGGG + Exonic
1168163586 19:54530190-54530212 AATTTTTCAAATATGGATCCTGG - Intergenic
1202638746 1_KI270706v1_random:63712-63734 AGTTTGGAAAATTTGGAGCCTGG - Intergenic
927059960 2:19407764-19407786 AATTCTACAAGGATGGAGCCAGG - Intergenic
931051590 2:58421262-58421284 AGTGTTGCAAGGATGGAAGCTGG - Intergenic
932169682 2:69542547-69542569 AGTTTTGCACTGATGCAGGCGGG + Exonic
932597566 2:73103603-73103625 ATTTTTGCGAATATGGAGACTGG - Intronic
933043400 2:77499548-77499570 AGTTTAGCAAAGATAGAGTGAGG - Intronic
935650933 2:105381451-105381473 AGCTTGTCAAAGGTGGAGCCAGG + Intronic
935936487 2:108190030-108190052 CGTTTTGCAAAGATATATCCTGG + Intergenic
938751937 2:134340617-134340639 AGGTTTGTAAAGAAGGAGCCTGG - Intronic
939632242 2:144538785-144538807 ATTTTAATAAAGATGGAGCCAGG + Intergenic
939666791 2:144962898-144962920 AGTTATGCAAACATGGGGACTGG + Intergenic
939811275 2:146835725-146835747 AGCTGTACAAAGATGGAGGCAGG + Intergenic
941300583 2:163796062-163796084 AATTTTGAAGAGATGGAGCCAGG - Intergenic
942101643 2:172589683-172589705 AGTTAGGTAAAGCTGGAGCCTGG + Intronic
943916611 2:193643575-193643597 AGCTGTGCTCAGATGGAGCCAGG + Intergenic
944427271 2:199596230-199596252 AGTTCTTCAAGGAAGGAGCCGGG + Intergenic
945111280 2:206362351-206362373 AGTTTTGGAAGGAAGGGGCCAGG - Intergenic
947211223 2:227710382-227710404 ATTTTTGTAGAGATGGAGTCTGG - Intronic
1168925334 20:1574515-1574537 AAGTTTGCAAAGCTGGACCCAGG - Intronic
1168929212 20:1607543-1607565 AAGTTTGCAAAGCTGGACCCAGG - Intronic
1170155253 20:13263288-13263310 AGTGTTGGAAAGAGGCAGCCAGG - Intronic
1171528357 20:25834019-25834041 AGTTTTGCAAAGATGGAGCCTGG + Intronic
1171548469 20:26021859-26021881 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1171885338 20:30647832-30647854 AGTTTGGAAAATTTGGAGCCTGG - Intergenic
1172854646 20:37992575-37992597 ATTTTTGAAAAGATGAAGTCAGG - Intronic
1173873077 20:46353754-46353776 GGTTTTGCAGAGATGGGGCATGG + Intronic
1173938246 20:46887609-46887631 AATTTTGCAAAGGTGGTTCCAGG + Intergenic
1175866250 20:62178721-62178743 ATTTTTGTAGAGATGGAGTCTGG + Intronic
1175938502 20:62526274-62526296 AGGTTTGCAAAGATGCAGTGAGG - Intergenic
1176343128 21:5716394-5716416 AGTTCTGCAAAGAGAGTGCCTGG - Intergenic
1176475382 21:7148545-7148567 AGTTCTGCAAAGAGAGTGCCTGG - Intergenic
1176501699 21:7608062-7608084 AGTTCTGCAAAGAGAGTGCCTGG + Intergenic
1176537449 21:8114463-8114485 AGTTCTGCAAAGAGAGTGCCTGG - Intergenic
1177170659 21:17651976-17651998 AGTGTTGCAAAAATGGAATCAGG + Intergenic
1178218314 21:30625850-30625872 AGTTTGGAAAAGTTGCAGCCTGG - Intergenic
1179402714 21:41098945-41098967 AGTTTTGAGAAGGTGCAGCCTGG - Intergenic
1180309451 22:11157772-11157794 AGTTTCCAAAAGATGGAGGCGGG + Intergenic
1180363221 22:11918177-11918199 AGTTTGGAAAATTTGGAGCCTGG + Intergenic
1180547928 22:16519583-16519605 AGTTTCCAAAAGATGGAGGCGGG + Intergenic
1182211532 22:28680788-28680810 AGTTTTCAAGAGATGGAGGCGGG - Intergenic
1184368751 22:44069249-44069271 TGTTTTGCAAGAATGGACCCTGG + Intronic
1203242392 22_KI270733v1_random:30819-30841 AGTTCTGCAAAGAGAGTGCCTGG - Intergenic
949648176 3:6122946-6122968 AAATTTGCAAGGTTGGAGCCTGG + Intergenic
950495723 3:13333230-13333252 AGTCTTGCAGAGAAGGGGCCTGG - Intronic
950571153 3:13800871-13800893 AGTTTTGCAAAGGTGAAATCTGG + Intergenic
952652087 3:35738873-35738895 GCTGTTGCAAAGATGGAGCCAGG - Intronic
954634693 3:52065134-52065156 GGTTTGGCAAAGATAGAACCAGG - Intergenic
954640464 3:52094725-52094747 AGTTTTGCAAAGCAGGTGACTGG + Intronic
956887276 3:73572889-73572911 AATTTTGAAAAGATGGCTCCGGG + Intronic
957096431 3:75780927-75780949 AGTTTTGAAAAGGTGGACCAAGG - Intronic
958739350 3:98050035-98050057 ATTTTTGAAAAGATGCAGCCTGG + Intergenic
960020288 3:112943548-112943570 AGTTTCGTAAAGTTGGAGTCTGG - Intronic
961465189 3:127077083-127077105 AGCTTTGCACAGATGGCCCCAGG - Intergenic
961915296 3:130368108-130368130 CCTTTTGAAAAGATGGAACCAGG + Intronic
964109599 3:153074777-153074799 AATTATGCAAAGATGTGGCCGGG - Intergenic
965270275 3:166607601-166607623 AGGATTTCAAAGAAGGAGCCAGG + Intergenic
965627663 3:170697890-170697912 AGTTTTCCCAAGATGCTGCCCGG - Intronic
966697869 3:182811344-182811366 ATTTTTGCAAACATGGCGTCTGG + Intronic
966917459 3:184592964-184592986 AGCTTTGCAAAGGAGGAGGCAGG + Intronic
970348980 4:15181827-15181849 AGTGTTGGAAACTTGGAGCCTGG + Intergenic
970817485 4:20174963-20174985 AGCTCTGCAAAGACCGAGCCAGG + Intergenic
972916742 4:43891059-43891081 AGTTTTGCAAAGAAGAAACTGGG - Intergenic
973368992 4:49230100-49230122 AGTTTGGAAAATTTGGAGCCTGG - Intergenic
973392050 4:49565315-49565337 AGTTTGGAAAATTTGGAGCCTGG + Intergenic
974577507 4:63746095-63746117 TGTTTTTTAGAGATGGAGCCTGG - Intergenic
974991998 4:69104333-69104355 ATTTTTATAAAGATGGAGTCTGG + Intronic
975952284 4:79788620-79788642 AGTTTGGAAAATATGAAGCCTGG + Intergenic
976167329 4:82269858-82269880 AGTTTTGTAAATATAGACCCAGG + Intergenic
976920626 4:90438195-90438217 AGTTGTGCAAAGATCAAGTCTGG - Intronic
978361233 4:107932427-107932449 ACTTTTGGAAAGATGGAACCTGG - Intronic
979298282 4:119057215-119057237 ACTTTTGCAAAGGTGGGGACAGG + Intronic
979467161 4:121053927-121053949 AATTTAGCTAAGATGGAGCATGG + Intronic
979717237 4:123854681-123854703 AGATTTGCAAAAATTGAGTCTGG + Intergenic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
983176092 4:164589270-164589292 TGTTTAAAAAAGATGGAGCCCGG - Intergenic
983307346 4:166007954-166007976 AATTTTCTGAAGATGGAGCCTGG + Exonic
983986006 4:174061165-174061187 AGTTTGGAAAATTTGGAGCCTGG - Intergenic
1202766084 4_GL000008v2_random:149571-149593 AGTTTGGAAAATGTGGAGCCTGG - Intergenic
985975240 5:3414885-3414907 AGTTTTGTAAAGATTTATCCAGG + Intergenic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
987070920 5:14336220-14336242 ATTTTTGCCAAGGTGGAGTCAGG - Intronic
988091151 5:26542653-26542675 AGTTTTGAAAATTTGCAGCCTGG - Intergenic
989474189 5:41855954-41855976 AGCTTTGCAAAGATGCACTCAGG + Intronic
990378621 5:55199133-55199155 AGTTTTCAAAAGATTTAGCCAGG + Intergenic
991323488 5:65403269-65403291 AGTGTTTCAAAGGTGGAGTCTGG - Intronic
995875475 5:116784723-116784745 ATTTGTGCAAAGTTGGGGCCAGG + Intergenic
997503543 5:134397610-134397632 ACTTTTGCAGGGATGGAGCCTGG + Intergenic
997888754 5:137656770-137656792 AGGTTTACAAAGGTGAAGCCAGG + Intronic
999702044 5:154237033-154237055 AGATTGGCAAAGATAGAGCTAGG + Intronic
1001958311 5:175863609-175863631 AGTCTTGGGAAGATGAAGCCAGG - Intronic
1002504066 5:179666641-179666663 TTTTTTGTAAAGATGGAGTCTGG + Intergenic
1007602431 6:43090852-43090874 AGTTTTGTAAGGAAGGAGCTAGG + Intronic
1008754184 6:54773879-54773901 AGTTTTGCAAAGAAGGGGTTTGG + Intergenic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1009564188 6:65290215-65290237 AGTTTAGTAAAGATGGAGAAAGG + Intronic
1011452914 6:87514476-87514498 AGCTTTGAAAAGATGAAGTCTGG + Exonic
1011669728 6:89671505-89671527 AGTTTTGTAAAGATGGGTTCTGG - Intronic
1011727969 6:90229986-90230008 AGGTTTGCTAATATGCAGCCAGG - Intronic
1013078681 6:106793361-106793383 AGTTTTGCCATGAGGGAGCTGGG - Intergenic
1013546057 6:111158787-111158809 AGTTTTGAAAAGATGTAGGCTGG + Intronic
1015342048 6:132111891-132111913 AGTTTTACAAATATGAAGCCGGG - Intergenic
1015629526 6:135217572-135217594 AATTTTACAAAGCTGGAGACAGG - Intronic
1018804136 6:167245842-167245864 CGTGTTGCTAAGATGAAGCCCGG - Intergenic
1018941818 6:168313551-168313573 AGCTATGCAAAGAGGAAGCCTGG + Intronic
1019058968 6:169242331-169242353 AGCTTTGCAAAGAGGGGACCTGG - Intronic
1019062909 6:169269486-169269508 TGTTTTGCAATGACGGAGGCAGG + Intergenic
1020694875 7:11401277-11401299 AGTTTTGCAAAAATGTTTCCCGG - Intronic
1027477899 7:78656173-78656195 AGTTAGGAAAAGATGGAGTCAGG - Intronic
1029161840 7:98558059-98558081 AGGTTTCCAATGATGGGGCCTGG - Intergenic
1029996474 7:105012901-105012923 AGTTTTGCAGAGGCCGAGCCGGG + Intergenic
1030323434 7:108194115-108194137 AGTTGTGCAAAGAGGGAGCATGG - Exonic
1032404332 7:131644783-131644805 AGTTTATCAAAGACGGAGCCAGG - Intergenic
1033193177 7:139302317-139302339 AGTTTTGCAAACATGGAAAGGGG - Exonic
1033672171 7:143503811-143503833 AGTTGGGCAAAGATGAAGCCAGG - Intergenic
1033730170 7:144170884-144170906 AGTTTGGAAAATATGCAGCCCGG + Intergenic
1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG + Intergenic
1035915689 8:3619334-3619356 TGTTCTGCAAACATGGAGCACGG + Intronic
1036794056 8:11742823-11742845 AGTTCACCAGAGATGGAGCCTGG - Intronic
1038676365 8:29626132-29626154 ACTTTGGCAAAGAAGGATCCTGG + Intergenic
1040991675 8:53358150-53358172 ATTTTTGTACAGGTGGAGCCTGG + Intergenic
1041139930 8:54806454-54806476 CATTTTGCTAAGATGTAGCCAGG - Intergenic
1041310661 8:56513139-56513161 AGCTTTGCTATGCTGGAGCCAGG + Intergenic
1041893278 8:62895788-62895810 AGTTTTGCAGAGAGGGAGTGGGG - Intronic
1042120766 8:65485739-65485761 AGTTTTGGAAACATGAACCCTGG - Intergenic
1043201188 8:77372100-77372122 AGTTTGGAAAATATGCAGCCTGG + Intergenic
1045702169 8:104879793-104879815 ACTTGTGGAAAGAGGGAGCCAGG - Intronic
1048063056 8:130940248-130940270 AGTTTTGCCAAGAGAGAGCATGG - Intronic
1048562808 8:135560036-135560058 ATTTTTGCAGAGATGGGGTCTGG - Intronic
1048734283 8:137481212-137481234 AGGTTTGGAAAGATGGAACGGGG + Intergenic
1049459394 8:142717021-142717043 AGTTTTGCAATGATGTATCCAGG - Intergenic
1051350219 9:16191986-16192008 AGGTTTGGAAAAATGGAACCTGG - Intergenic
1051999106 9:23254694-23254716 AGTTTTGTAAAGAATGAGCTGGG - Intergenic
1052810690 9:33056414-33056436 AGCTTTGCAAAGAAAGAGGCTGG + Intronic
1052990299 9:34515043-34515065 ATTTTTCCTTAGATGGAGCCGGG - Intronic
1053302085 9:36959519-36959541 ACTTTTGCAAAGGAGGAGCTTGG + Intronic
1053796323 9:41730152-41730174 AGTTTTGCAAAGATGTAGCCTGG + Intergenic
1054148858 9:61584710-61584732 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054184729 9:61942222-61942244 AGTTTTGCAAAGATGGAGCCTGG + Intergenic
1054468621 9:65515819-65515841 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054653778 9:67646275-67646297 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054783780 9:69190750-69190772 AGTTTTGCATAAATTGAGTCTGG + Intronic
1054878368 9:70120236-70120258 TGTGATGCAGAGATGGAGCCTGG - Intronic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1059915435 9:119094502-119094524 AGTTAGTAAAAGATGGAGCCAGG - Intergenic
1061265769 9:129504122-129504144 AGTTGTAGAAAGATGGGGCCAGG + Intergenic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1061844511 9:133379557-133379579 AGTTTTACCAAAAGGGAGCCAGG + Intronic
1203458720 Un_GL000220v1:13896-13918 AGTTCTGCAAAGAGAGTGCCTGG - Intergenic
1203546831 Un_KI270743v1:134460-134482 AGTTTGGAAAATGTGGAGCCTGG - Intergenic
1186917525 X:14239484-14239506 ACTTTTCCAAAAATGTAGCCAGG - Intergenic
1187265580 X:17729644-17729666 ATTTTTGCAAATATGGACCATGG - Intronic
1187717573 X:22118536-22118558 AGTTTTCAAAAGATAAAGCCTGG - Intronic
1187719984 X:22140035-22140057 AGTAGTGCTAAGGTGGAGCCTGG + Intronic
1188043799 X:25402347-25402369 TGTTGGGCCAAGATGGAGCCTGG + Intergenic
1192202521 X:69075766-69075788 AGTTTGACAGAGATGCAGCCAGG + Intergenic
1192266269 X:69540069-69540091 AGTTACCCCAAGATGGAGCCAGG - Intergenic
1193560512 X:83011595-83011617 AGTTTGGCAAAGATGGGCCTTGG + Intergenic
1194876563 X:99196302-99196324 ATATTTGTAAAGATGGGGCCTGG + Intergenic
1195804300 X:108745724-108745746 AGTTCTGCAAAGAGTGAGACAGG + Intergenic
1196426822 X:115578428-115578450 AGTTTTGAAAAGATAAAGCTAGG + Intronic
1196740084 X:119017105-119017127 AGTTTTGTGATGAAGGAGCCTGG - Intronic
1196970284 X:121100433-121100455 AGTTTGGCAAATTTGTAGCCTGG - Intergenic
1198140905 X:133802495-133802517 AGTTTTGCAAATCTGCAGGCAGG - Intronic
1200042887 X:153382454-153382476 AGCTTCCCATAGATGGAGCCAGG - Intergenic