ID: 1054657140

View in Genome Browser
Species Human (GRCh38)
Location 9:67675529-67675551
Sequence CTACCTTCAAGAAGCTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054657132_1054657140 14 Left 1054657132 9:67675492-67675514 CCTCTCACCAGTCACCACAGGGC No data
Right 1054657140 9:67675529-67675551 CTACCTTCAAGAAGCTCAGCAGG No data
1054657133_1054657140 7 Left 1054657133 9:67675499-67675521 CCAGTCACCACAGGGCCCTGACT No data
Right 1054657140 9:67675529-67675551 CTACCTTCAAGAAGCTCAGCAGG No data
1054657136_1054657140 -9 Left 1054657136 9:67675515-67675537 CCTGACTCCCATTCCTACCTTCA No data
Right 1054657140 9:67675529-67675551 CTACCTTCAAGAAGCTCAGCAGG No data
1054657135_1054657140 -8 Left 1054657135 9:67675514-67675536 CCCTGACTCCCATTCCTACCTTC No data
Right 1054657140 9:67675529-67675551 CTACCTTCAAGAAGCTCAGCAGG No data
1054657134_1054657140 0 Left 1054657134 9:67675506-67675528 CCACAGGGCCCTGACTCCCATTC No data
Right 1054657140 9:67675529-67675551 CTACCTTCAAGAAGCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054657140 Original CRISPR CTACCTTCAAGAAGCTCAGC AGG Intergenic
No off target data available for this crispr