ID: 1054660460

View in Genome Browser
Species Human (GRCh38)
Location 9:67698147-67698169
Sequence GACCCAGGCATTATTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054660460_1054660464 -4 Left 1054660460 9:67698147-67698169 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054660464 9:67698166-67698188 GGTCAAGTTAGGGAAGATCCAGG No data
1054660460_1054660465 10 Left 1054660460 9:67698147-67698169 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054660465 9:67698180-67698202 AGATCCAGGTCCCTCTGCTGAGG No data
1054660460_1054660466 11 Left 1054660460 9:67698147-67698169 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054660466 9:67698181-67698203 GATCCAGGTCCCTCTGCTGAGGG No data
1054660460_1054660469 20 Left 1054660460 9:67698147-67698169 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054660469 9:67698190-67698212 CCCTCTGCTGAGGGACAGTTTGG No data
1054660460_1054660471 23 Left 1054660460 9:67698147-67698169 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054660471 9:67698193-67698215 TCTGCTGAGGGACAGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054660460 Original CRISPR GACCCAGGCATTATTTCCCC AGG (reversed) Intergenic
No off target data available for this crispr